| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.064562 |
| Chromosome: | chromosome 2 |
| Location: | 5811802 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g117050 | (1 of 2) IPR000014//IPR000719//IPR001245//IPR002290//IPR011009//IPR020635//IPR029016 - PAS domain // Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain // GAF domain-like; Protein tyrosine kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCTGAGGTGGCTAGGACCGCATCCCTCTGATGCCTTGTTCGGACGGT |
| Internal bar code: | GGATATCTTCCGCTTATCACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 622 |
| LEAP-Seq percent confirming: | 41.0256 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTGGAGCTCAAACTGGAT |
| Suggested primer 2: | TGATCATGGGGCAAGGTGAC |