| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.064570 |
| Chromosome: | chromosome 5 |
| Location: | 1073026 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247850 | (1 of 3) 3.6.1.22//3.6.1.55 - NAD(+) diphosphatase / NADP pyrophosphatase // 8-oxo-dGTP diphosphatase / 8-oxo-dGTPase | 5'UTR | |
| Cre05.g247851 | CEP2 | Cysteine endopeptidase; (1 of 2) 3.4.22.14 - Actinidain / Actinidin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCCATCAGAACACATTCCGCTTATATTTTCTCAATCTAGGCGTGCGA |
| Internal bar code: | GGCGTCTCTTCGTAAGCGGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 814 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATCGCGTGTTTCTGATGGC |
| Suggested primer 2: | CTTTTGCGTTTGGAGGGTGG |