| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.064592 |
| Chromosome: | plastome |
| Location: | 190074 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802332 | ChreCp067,2717046,psaC | photosystem I iron-sulfur center; (1 of 1) K02691//K05575 - photosystem I subunit VII (psaC) // NAD(P)H-quinone oxidoreductase subunit 4 (ndhD) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGATACTCCCTTTTTTAAAGGTTTTTTAAACGCCAAGTGAATTAAAAAA |
| Internal bar code: | CCGTATTTAACACTCGCGTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 175 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTCCGGTTCCTGGCAATT |
| Suggested primer 2: | GCCTTTGGCTGGAAGAGTCT |