| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.064603 |
| Chromosome: | chromosome 2 |
| Location: | 43151 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g073200 | THD1 | putative threonine dehydratase and component psaA trans-splicing sub complex II; (1 of 1) K01754 - threonine dehydratase (E4.3.1.19, ilvA, tdcB) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCACGCCACGTTCCACTGCATCCCATGCATGGCGCTTGCCCTGCGTGC |
| Internal bar code: | GACGAAAAAATGGCGAGGTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4735 |
| LEAP-Seq percent confirming: | 97.4359 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTAGGGCATTCGGTGGGA |
| Suggested primer 2: | CTTCCCGCCATGCATCATTG |