Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.064611 |
Chromosome: | chromosome 12 |
Location: | 4941497 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g524400 | (1 of 1) IPR003128//IPR007122//IPR029919 - Villin headpiece // Villin/Gelsolin // Protein flightless-1 | 3'UTR | |
Cre12.g524450 | PTP3 | Protein tyrosine phosphatase; (1 of 1) PF00102//PF00782 - Protein-tyrosine phosphatase (Y_phosphatase) // Dual specificity phosphatase, catalytic domain (DSPc) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGTACAATTGGTTCAATCCATCATGCGTAGCAAACAAGATTACGCAAG |
Internal bar code: | ACTAGGCTAGTGAATGGCAAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3095 |
LEAP-Seq percent confirming: | 97.8723 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATGGACCGCGATGCTTTC |
Suggested primer 2: | CTGGCGCAGATATGTTTGCC |