| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.064640 |
| Chromosome: | chromosome 5 |
| Location: | 1140746 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g248300 | NRAMP4 | Manganese/metal transporter, NRAMP homolog; (1 of 1) K12347 - natural resistance-associated macrophage protein (SLC11A, NRAMP) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATATACCGTATGTCACGTGCATGGCAGTTTGCATCGGCTGCACTCGCTC |
| Internal bar code: | TGAACAAAACATAGCTTATTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 632 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAACGAGGGGGAGGATGAA |
| Suggested primer 2: | AGCTCGACACCAATCCTGTG |