| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.064672 |
| Chromosome: | chromosome 5 |
| Location: | 352186 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g243450 | GOX1 | (1 of 1) IPR000095//IPR003882//IPR009880//IPR011043//IPR013783//IPR014756//IPR015202//IPR015916 - CRIB domain // Pistil-specific extensin-like protein // Glyoxal oxidase, N-terminal // Galactose oxidase/kelch, beta-propeller // Immunoglobulin-like fold // Immunoglobulin E-set // Domain of unknown function DUF1929 // Galactose oxidase, beta-propeller; Glyoxal oxidase 1 | 5'UTR |
| Cre05.g243451 | (1 of 2) K06287 - septum formation protein (maf) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCTCCTTCCACTGGTGTACGATTGCAACCCCGCCATGACCCAGTGCC |
| Internal bar code: | TTCATGTGCACATGTAGTTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1038 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCGGCTTCCTAGAATCCAT |
| Suggested primer 2: | GACTCTGCGGCGAATGTTTC |