| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.064696 |
| Chromosome: | chromosome 10 |
| Location: | 6127397 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g462200 | HDA17,SRTA1,SRTA | Sir2-like NADH dependent histone deacetylase; (1 of 1) K11416 - mono-ADP-ribosyltransferase sirtuin 6 (SIRT6, SIR2L6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATCGAATGGTTGGAGGACGAGGTGTCAGTGACCTGCAGTAATACTGCA |
| Internal bar code: | CTTACCACTTGTATCGTTTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 839 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCTGCATGGACTGTACTT |
| Suggested primer 2: | CCTAGTGGACATGGACGAGC |