| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.064705 |
| Chromosome: | chromosome 10 |
| Location: | 4870337 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g453600 | DES,FAD13 | (1 of 2) PTHR19353:SF30 - FATTY ACID DESATURASE 2; Fatty acid omega 13 desaturase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGTGCCCCTGATCGCAGCATGTAGGGGCATAAGCATGACTGGCAGCC |
| Internal bar code: | TTAAGCCGTTGTGGGTGGTATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2558 |
| LEAP-Seq percent confirming: | 77.0833 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGTGATCGCGGTGTAGG |
| Suggested primer 2: | CCCTGTCCTGCACGGATATC |