| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.064761 |
| Chromosome: | chromosome 4 |
| Location: | 1438556 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214150 | THI4 | Thiazole biosynthetic enzyme; (1 of 1) K03146 - thiamine thiazole synthase (THI4, THI1) | 5'UTR |
| Cre04.g214200 | (1 of 30) IPR000253 - Forkhead-associated (FHA) domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAACCGAAACTTTTCGGCCCCTCCGCGACGCTTTTCAGCCCCGATGAA |
| Internal bar code: | GTTACGGCAGTAGACGTTTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2568 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTAAGCGAACTTCATGCGG |
| Suggested primer 2: | TTACCGTCAGTGACATGCCC |