Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.064773 |
Chromosome: | chromosome 16 |
Location: | 7387081 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g680342 | FAP110 | Flagellar Associated Protein 110; (1 of 19) IPR000225//IPR016024 - Armadillo // Armadillo-type fold | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAACTGTCTAAACTGATCTGCCAAGCCTGTTGCACCAACTCTCGAGGCC |
Internal bar code: | AGAAGCGATTTTACTGCGATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3969 |
LEAP-Seq percent confirming: | 97.8495 |
LEAP-Seq n confirming: | 91 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 93 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGAAGCCCATATCTCGCAT |
Suggested primer 2: | CAGCCCATCAACCAGGTCAT |