Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.064863 |
Chromosome: | chromosome 11 |
Location: | 1780603 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467850 | PGA6 | (1 of 2) K13511 - monolysocardiolipin acyltransferase (TAZ); Putative phospholipid/glycerol acyltransferase | outside_mRNA |
Cre11.g801280 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAACCTTCAAGTCACCAGGCAGGATATTGGACACACAGGGACACACC |
Internal bar code: | AGTCCGTAGGGGTGCATTGGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1062 |
LEAP-Seq percent confirming: | 84.2105 |
LEAP-Seq n confirming: | 16 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTAGGTAAGCCAGTTGGT |
Suggested primer 2: | CTTTCACATCCACCCCCTCC |