| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.064870 |
| Chromosome: | chromosome 3 |
| Location: | 7727033 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203500 | Protein tyrosine kinase; (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) | 5'UTR | |
| Cre03.g203550 | GT90-3,GT90F3 | GT90 family protein 3; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGCAGTCCTGTCGCGCGCAGTTGGCACATTGCCGGACCTCACAGACT |
| Internal bar code: | TGACTGGGTGCGGCAAGGCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3076 |
| LEAP-Seq percent confirming: | 96.8254 |
| LEAP-Seq n confirming: | 61 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCACAATCGCTTACCACC |
| Suggested primer 2: | ATCGAAAGCCGCCTTGTACA |