| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.064904 |
| Chromosome: | chromosome 1 |
| Location: | 3659429 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g023773 | (1 of 6) IPR000253//IPR008984 - Forkhead-associated (FHA) domain // SMAD/FHA domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGAATCAAGGTGTGCACTGATGGAGTTGCCTGTGCTGGGGCATATGCC |
| Internal bar code: | GCAATTTCTGAGCCCGGTGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 726 |
| LEAP-Seq percent confirming: | 44.8276 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGACTGATGGGCATTGGGG |
| Suggested primer 2: | TTATCCGCACGTCGCTACTC |