Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.064931 |
Chromosome: | chromosome 17 |
Location: | 1878147 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g709600 | 3'UTR | ||
Cre17.g802046 | (1 of 7) PF00415//PF13540 - Regulator of chromosome condensation (RCC1) repeat (RCC1) // Regulator of chromosome condensation (RCC1) repeat (RCC1_2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCACAGGGGGGGCCGGGACAACGAGGAGAGGCGGAGAGTAGCGGCTG |
Internal bar code: | TTAGTTGTCGCAGTTGGTGTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 976 |
LEAP-Seq percent confirming: | 91.6667 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGCACAACAACGAAGCTC |
Suggested primer 2: | ACACTAGTACACGCAACGCA |