| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.064934 |
| Chromosome: | chromosome 2 |
| Location: | 2904023 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095000 | PLA2 | (1 of 1) PTHR11716//PTHR11716:SF47 - PHOSPHOLIPASE A2 // PROTEIN C07E3.9; Phospholipase A2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTACCACACGCAGCTTCCCAGATGCTACCGCACGATACTACAGGCTTC |
| Internal bar code: | CAAAAACGAACCTGTCTCTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1771 |
| LEAP-Seq percent confirming: | 81.1321 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCCCATTGCCACCATTAC |
| Suggested primer 2: | CATTCCAACCCGTCTGCTCT |