| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.065059 |
| Chromosome: | chromosome 2 |
| Location: | 5292737 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g112800 | (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | 5'UTR | |
| Cre02.g112850 | COQ6 | (1 of 1) K06126 - ubiquinone biosynthesis monooxygenase Coq6 (COQ6); Flavin-dependent monoxygenase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGGCCAGTAAACGTGAATATGTGTAAACAATAAATTGTAATGGATATT |
| Internal bar code: | GGCCTTTTCTATACGCAACGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1340 |
| LEAP-Seq percent confirming: | 77.0833 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGCGTGTGGGTTGGATAC |
| Suggested primer 2: | CCTCTGGAGCGCATGTAGAG |