Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.065068 |
Chromosome: | chromosome 13 |
Location: | 1906861 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g575850 | (1 of 10) PF13460 - NAD(P)H-binding (NAD_binding_10) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCAGTGCAAAACTTATCATATATTGATACAACAGTGCATGCACGCGG |
Internal bar code: | GCTTGGTCGCAAACAGGCAATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2174 |
LEAP-Seq percent confirming: | 96.7742 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACGCACATGTTCCAGTCCT |
Suggested primer 2: | CGGAATGCGCGAGTACTTTG |