Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.065168 |
Chromosome: | chromosome 3 |
Location: | 3383126 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g166500 | (1 of 2) IPR000104//IPR013083 - Antifreeze protein, type I // Zinc finger, RING/FYVE/PHD-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCAGAGTTGCCAATCCTGTATCCGCCCGCAGTCTTCTAGGGTGTTGCC |
Internal bar code: | CCCGAGGATAAGCTCTGGGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1899 |
LEAP-Seq percent confirming: | 98.3607 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 61 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGACATCCTACTGCCATCCC |
Suggested primer 2: | CAGCGGCTGAAGTAGAAGGG |