| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.065172 |
| Chromosome: | chromosome 6 |
| Location: | 3585753 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278128 | (1 of 1) IPR000953//IPR005818//IPR016197 - Chromo/chromo shadow domain // Linker histone H1/H5, domain H15 // Chromo domain-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGCGTAGTCCCGTAGTGTGCAGCGTACTCCCAGATCCCAGTTTGCAA |
| Internal bar code: | CTTGGTAACTTCTAGTTGCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1273 |
| LEAP-Seq percent confirming: | 63.3803 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCACTAAAGCAATCGCGG |
| Suggested primer 2: | CCTTTCGCTTCCCCTCACTT |