| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.065197 |
| Chromosome: | chromosome 1 |
| Location: | 4077691 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g027000 | RPL11 | (1 of 1) K02868 - large subunit ribosomal protein L11e (RP-L11e, RPL11); Cytosolic 80S ribosomal protein L11 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAAGTCCTGCAGCTAATGGCACCAACACAGTCCAAACTGAAACAACAGC |
| Internal bar code: | TTGGCAAGAATAGCAGTTTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1129 |
| LEAP-Seq percent confirming: | 94.5455 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 55 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACATGATGCTTACGGGGCA |
| Suggested primer 2: | GGCTGTGCGTTGACATTGTT |