| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.065244 |
| Chromosome: | chromosome 16 |
| Location: | 3273748 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g666250 | TPT26,TPT27 | (1 of 2) K15281 - solute carrier family 35 (SLC35D); UDP-N-acetylglucosamine transporter | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCTAGCTCGGAATGTGCCATATTTGGCCCACTTTTGGCCCAGACCGC |
| Internal bar code: | AGCCTAACACATTAACATGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3281 |
| LEAP-Seq percent confirming: | 87.8788 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCATCCAGAACACTCCCA |
| Suggested primer 2: | TGGGGTTCATGACATGGCTC |