Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.065244 |
Chromosome: | chromosome 16 |
Location: | 3273748 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g666250 | TPT26,TPT27 | (1 of 2) K15281 - solute carrier family 35 (SLC35D); UDP-N-acetylglucosamine transporter | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCTAGCTCGGAATGTGCCATATTTGGCCCACTTTTGGCCCAGACCGC |
Internal bar code: | AGCCTAACACATTAACATGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3281 |
LEAP-Seq percent confirming: | 87.8788 |
LEAP-Seq n confirming: | 29 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCATCCAGAACACTCCCA |
Suggested primer 2: | TGGGGTTCATGACATGGCTC |