| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.065276 |
| Chromosome: | plastome |
| Location: | 14950 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802268 | 2717012,rpl20,ChreCp006 | 50S ribosomal protein L20; (1 of 1) PTHR10986//PTHR10986:SF12 - 39S RIBOSOMAL PROTEIN L20 // 50S RIBOSOMAL PROTEIN L20, CHLOROPLASTIC | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACGTCTGCGGGAAGATTAATTGACTCTGCTTTGAAGAACTCCAATTT |
| Internal bar code: | CTGTACATCCTGTAGCATCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 97 |
| LEAP-Seq percent confirming: | 13.0435 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAAATTGGCGTGGCTTCG |
| Suggested primer 2: | TCAGGCCCAGTAGGAATCGA |