| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.065319 |
| Chromosome: | chromosome 17 |
| Location: | 862247 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g702250 | TRP4 | Transient receptor potential ion channel protein; (1 of 6) PTHR10582 - TRANSIENT RECEPTOR POTENTIAL ION CHANNEL PROTEIN | 3'UTR |
| Cre17.g702300 | (1 of 2) PF04930 - FUN14 family (FUN14) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAATGCACAACTCACAGTTCCAGCCATCCCCGAATGGCATCAACCTCCG |
| Internal bar code: | GGGCGGGCAGCCTCGGAGCTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 245 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGACCTGAGACACGCAAC |
| Suggested primer 2: | GGTTAGAGGGGACTTGGTGC |