Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.065322 |
Chromosome: | chromosome 1 |
Location: | 5672530 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g040550 | (1 of 1) PF15378 - Domain of unknown function (DUF4605) (DUF4605) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGGATCTGGCATTCTGCCTCCCCTCTGACCTCACCGCGGCTGCGAACA |
Internal bar code: | TGCGAGCAGCGGTTCGGCGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5493 |
LEAP-Seq percent confirming: | 97.1963 |
LEAP-Seq n confirming: | 104 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 107 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACCGCCAGCAACACTATGA |
Suggested primer 2: | ATCGCTGGACCACTTGAAGG |