Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.065346 |
Chromosome: | chromosome 15 |
Location: | 1211925 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g801719 | NCL59 | Nuclear Control of chloroplast-Like 59; (1 of 5) IPR013584//IPR016024 - RAP domain // Armadillo-type fold | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGTTAGCCTCGTGCTGGCTGTGCTGCCTCCACACATCAGGAAGAATA |
Internal bar code: | TGAGACGGGGCGGCTAGTGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 830 |
LEAP-Seq percent confirming: | 64.7059 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGGTGGTGATGGTAGTGG |
Suggested primer 2: | CATTCTCGCGCCTGACAATG |