Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.065348 |
Chromosome: | chromosome 16 |
Location: | 6280464 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676200 | (1 of 3) PTHR10751:SF2 - GUANYLATE-BINDING PROTEIN | 5'UTR | |
Cre16.g676250 | MFT28 | Major facilitator superfamily transporter; (1 of 2) PTHR23121:SF9 - SODIUM-DEPENDENT GLUCOSE TRANSPORTER 1 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACACGAAAGCTTCTTATTCCGCACCCTATCTTTTATCGCGCTGCTAGGC |
Internal bar code: | GGTGATGCAGCATTGGGTGTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2962 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 60 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 60 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCTGCTTGCCACTTCGAA |
Suggested primer 2: | CACGTCCACCTTACTGGCTT |