| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.065384 |
| Chromosome: | plastome |
| Location: | 130259 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802318 | ChreCp054,2716983,atpF | ATP synthase CF0 B subunit; (1 of 1) PTHR34264:SF3 - ATP SYNTHASE SUBUNIT B, CHLOROPLASTIC | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTAGGACGGCAATGTATATTTATATACTAGGACGTCCCCTTACGGGAA |
| Internal bar code: | GCTTTGTAACGGGTAGTTTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 815 |
| LEAP-Seq percent confirming: | 36.8421 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGTCAGTGACTGTTCGCA |
| Suggested primer 2: | CGTACGTGCGGCAGTTAATT |