| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.065419 |
| Chromosome: | chromosome 11 |
| Location: | 2156628 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467739 | IFT54,Traf3ip1,FAP116,Dyf-11Elipsa | Intraflagellar Transport Protein 54; (1 of 1) PTHR31363:SF0 - TRAF3-INTERACTING PROTEIN 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACGCACGAAAGAGTCTACTGGTGCCTCGTCGTAATGCATTTCGGCATTA |
| Internal bar code: | AGGGGAACAAGGTCTCGTATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3689 |
| LEAP-Seq percent confirming: | 98.2456 |
| LEAP-Seq n confirming: | 112 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 114 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCATCATTGGCATGAAGGG |
| Suggested primer 2: | GTTCTGTCGACCCAAGCTCA |