| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.065451 |
| Chromosome: | chromosome 1 |
| Location: | 2805457 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g017200 | FKB24,FKB99 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 2) PTHR10516//PTHR10516:SF290 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // PEPTIDYL-PROLYL CIS-TRANS ISOMERASE | 5'UTR |
| Cre01.g017250 | FKB99 | Chlorophyceae-specific protein; (1 of 2) K09571 - FK506-binding protein 4/5 (FKBP4_5) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGCAATGACATAGTGTCATGAGTGCACTGCTAGAAAGGACCCACTGAA |
| Internal bar code: | TATCAAGTCCTGTAACATTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 737 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCCTGTATGGCGATCTCC |
| Suggested primer 2: | AACCGGTCCACACTCATGTC |