| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.065491 |
| Chromosome: | chromosome 3 |
| Location: | 602518 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145427 | (1 of 3) 2.1.1.100 - Protein-S-isoprenylcysteine O-methyltransferase / Prenylcysteine carboxyl methyltransferase | 5'UTR | |
| Cre03.g145447 | TTLL3,TTLL8 | Tubulin monoglycylase; (1 of 1) K16608 - tubulin monoglycylase TTLL3/8 [EC:6.3.2.-] (TTLL3_8) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACAACCACATTTCGGCTTGCAAAGAGAAAGGAGGAAGAGCCGCATGC |
| Internal bar code: | GTATAGTGGGATAAGCTTTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2558 |
| LEAP-Seq percent confirming: | 97.931 |
| LEAP-Seq n confirming: | 142 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 145 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTGAGACTATCGTCGCC |
| Suggested primer 2: | TTACACCATGGGGGCATGTC |