| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.065529 |
| Chromosome: | chromosome 11 |
| Location: | 3591439 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g478050 | (1 of 12) IPR000104//IPR002893 - Antifreeze protein, type I // Zinc finger, MYND-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAATCTCCGTGCTTGACGCTACCATTCCATACGCAGCAGGGATCAAGAC |
| Internal bar code: | GTGACGGATTGGCTAAGCGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 861 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTAAAACGAGTGTGGGGG |
| Suggested primer 2: | GCGCACTACTTACACAAGCG |