| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.065541 |
| Chromosome: | chromosome 6 |
| Location: | 2598844 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g269865 | SMM18 | (1 of 1) IPR000104//IPR029044 - Antifreeze protein, type I // Nucleotide-diphospho-sugar transferases; S-adenosyl-L-methionine-dependent methyltransferase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGGTGTACCTCTGCTCTGCAGAGGGCGGGGGGCGCAGCGTGCGTGCGT |
| Internal bar code: | GTGAGGCAAGATTTTATCTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1164 |
| LEAP-Seq percent confirming: | 51.3514 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCCATCCACACAAGTCGTT |
| Suggested primer 2: | TGGGATGCGTGCTGTTTAGT |