| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.065587 |
| Chromosome: | chromosome 1 |
| Location: | 5693681 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g800099 | (1 of 1) IPR002048//IPR010308 - EF-hand domain // TRP-like family | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCAGCAACGCCTACTGCCTCAACGGCGTGGACACGTCGTCATCCTCCA |
| Internal bar code: | GCCTCTCGCGGCGACACAGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1475 |
| LEAP-Seq percent confirming: | 90.0 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGCGGACCTGTGACTATC |
| Suggested primer 2: | GTGCATCGGAAGCGGAATTC |