Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.065604 |
Chromosome: | chromosome 2 |
Location: | 1966855 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g088000 | POC17,PHB1 | Proteome of centriole protein 17; (1 of 1) K17081 - prohibitin 2 (PHB2) | 3'UTR |
Cre02.g088050 | RPP30,XRP30 | Ribonuclease MRP subunit P30; (1 of 1) K03539 - ribonuclease P/MRP protein subunit RPP1 (RPP1, RPP30) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCTAGCTGCGAAGATAGGAAGATGTAAAATGCTGTGGGCCAACTTCT |
Internal bar code: | GGGAAACCTGAAATGACGGAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3291 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 77 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 77 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGTGCATGGCCTTGAAGC |
Suggested primer 2: | GGTGAAAAGTGTGGCTGCAG |