Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.065636 |
Chromosome: | chromosome 3 |
Location: | 6732602 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g196150 | uL5m,MRPL5 | (1 of 3) IPR022803 - Ribosomal protein L5 domain; Mitochondrial ribosomal protein L5 | 3'UTR |
Cre03.g196200 | (1 of 2) PTHR17630//PTHR17630:SF32 - DIENELACTONE HYDROLASE // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAAGCATACTACATGCTGTATTTAAAAGCCACGATGCAGACATGGGGCT |
Internal bar code: | TGCGATCAGCTTGACGATGATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3784 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 90 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAACCGACCCCAGCTATGT |
Suggested primer 2: | TGAGGACCCTTAGGAGAGGC |