Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.065730 |
Chromosome: | chromosome 4 |
Location: | 3349754 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g227350 | CCR4 | Putative NOT-complex component; (1 of 1) K12580 - CCR4-NOT transcription complex subunit 3 (CNOT3, NOT3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGCCTTGGCCGCTGCCGCTGCCGCGCGCTCCCGCTCTCGCTCCTTTT |
Internal bar code: | GGTGAAGGGCGTGCGCAAGACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 368 |
LEAP-Seq percent confirming: | 60.0 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACCGTTTTGCTGTGCGTA |
Suggested primer 2: | CAGCTTCAGGTTGGTGTTGC |