| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.065739 |
| Chromosome: | chromosome 8 |
| Location: | 2144952 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g369800 | DHS2 | Deoxyhypusine synthase; (1 of 2) 2.5.1.46 - Deoxyhypusine synthase / Spermidine dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCTCCGTGCAACAGGTGAGGAGCTGCGCAAGCAGGGCCTCAACCGCA |
| Internal bar code: | TAGATGGCACATCATCCACAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 893 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAACGCACACACAGTCACAC |
| Suggested primer 2: | CAACCCGTGCTGTGAACTTG |