| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.065750 |
| Chromosome: | chromosome 12 |
| Location: | 5446172 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529651 | RPL7A | (1 of 1) K02936 - large subunit ribosomal protein L7Ae (RP-L7Ae, RPL7A); Cytosolic 80S ribosomal protein L7a | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGTGCCTTGGGCTGCACGGTCTGGGCTGAACCCGTTGACTAGCGCTGT |
| Internal bar code: | TTTAGTATTAATCATACCCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2718 |
| LEAP-Seq percent confirming: | 98.2143 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCATACTCGCTCACCCCC |
| Suggested primer 2: | ACGCGAGGTTAACTTCAGCA |