| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.065762 |
| Chromosome: | chromosome 17 |
| Location: | 1503406 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g706900 | CNG3 | Cyclic-nucleotide gated potassium channel; (1 of 4) IPR000595//IPR003938//IPR005821//IPR018490 - Cyclic nucleotide-binding domain // Potassium channel, voltage-dependent, EAG/ELK/ERG // Ion transport domain // Cyclic nucleotide-binding-like | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCGACGTGGGCCACGAAATGTACTTCATCACAAAGGTGCGGCCGCGGG |
| Internal bar code: | GCGCGAGTCAAGCTTCACTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 314 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGGGGGATGATCCAGGT |
| Suggested primer 2: | ATAACCCCCTCTTCCTCCCC |