| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.065766 |
| Chromosome: | chromosome 1 |
| Location: | 3711141 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g024200 | (1 of 1) PTHR23139:SF8 - CLEAVAGE STIMULATION FACTOR 64 KILODALTON SUBUNIT | 3'UTR | |
| Cre01.g024250 | HEL4 | DEAH box ATP-dependent RNA helicase; (1 of 1) 1.14.13.101 - Senecionine N-oxygenase / Senecionine monooxygenase (N-oxide-forming) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTGCATGATTGTCGAGTGCGCACGCATGTAAGCTGCGTGGCCCTAAG |
| Internal bar code: | ATTATGAGTTAGTGATAGTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1691 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATCACATTTCCGACGGA |
| Suggested primer 2: | ATCACGCTCTCCCTCTCCTT |