| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.065778 |
| Chromosome: | chromosome 12 |
| Location: | 3366790 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g498250 | RPS17 | Cytosolic 80S ribosomal protein S17; (1 of 1) K02962 - small subunit ribosomal protein S17e (RP-S17e, RPS17) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGAACCGCATGAATGCGGATGTTACAGAGGTGACAGTCCCAGCACCCGA |
| Internal bar code: | GAAATCTTCCGTCTAGATAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2376 |
| LEAP-Seq percent confirming: | 96.2264 |
| LEAP-Seq n confirming: | 51 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGACATCTTGGCGGGTA |
| Suggested primer 2: | TACGCTTGGGCTTCTTCCAG |