Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.065803 |
Chromosome: | chromosome 11 |
Location: | 2319908 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095136 | (1 of 6) IPR007577//IPR029044 - Glycosyltransferase, DXD sugar-binding motif // Nucleotide-diphospho-sugar transferases | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACTCGTACAGCTTGAAGCGGACGCAGGAGCAGTTGAGAGCCCTGGGC |
Internal bar code: | CCAATCAGCGTGGTGTCAAAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 900 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGGCAGTAGCAGTAGTAGG |
Suggested primer 2: | CCAACCCCATCTCCAACTCC |