| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.065804 |
| Chromosome: | chromosome 1 |
| Location: | 7023198 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g800128 | (1 of 4) PTHR11229:SF5 - 50S RIBOSOMAL PROTEIN L3-1, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCGTGCCAAGTCCCAAAAACAATTATATGATTGTGACGCTCCACATA |
| Internal bar code: | TGATGAAGCACCTACTGGCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2444 |
| LEAP-Seq percent confirming: | 0.854701 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 116 |
| LEAP-Seq n unique pos: | 117 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCCGAATTCCTAACCCCC |
| Suggested primer 2: | TCTGTGCCTCTGTCTGCTTG |