| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.065825 |
| Chromosome: | chromosome 8 |
| Location: | 3708440 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g380300 | MSRA3 | (1 of 1) PTHR10173//PTHR10173:SF30 - METHIONINE SULFOXIDE REDUCTASE // SUBFAMILY NOT NAMED; Peptide methionine-S-sulfoxide reductase, msrA-type | 3'UTR |
| Cre08.g380350 | (1 of 117) IPR002893 - Zinc finger, MYND-type | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTCGAAGACAATGAGGCAAACTTTGAGGCGCCCCGCTTGAGCTTATGT |
| Internal bar code: | TTAGATACTCGCACGGCACGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1404 |
| LEAP-Seq percent confirming: | 96.5517 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATACCGTCGTAGTCCTGCC |
| Suggested primer 2: | TTGCGGCTTGGTTAGGTGAT |