| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.065826 |
| Chromosome: | chromosome 12 |
| Location: | 178060 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g484600 | DMC6 | Putative DNA methylase; (1 of 1) 2.1.1.204 - tRNA (cytosine(38)-C(5))-methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGGCCCATGCTTGCTCGGCGCCTGCAGCGATGTCGCCAACTCCCCCA |
| Internal bar code: | ATAGAGGTAGCGCAGTCGTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 254 |
| LEAP-Seq percent confirming: | 27.2727 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACTTCAAAACTCGCGTGCC |
| Suggested primer 2: | GCTGTCACTCTTCCTGCAGT |