| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.065846 |
| Chromosome: | chromosome 6 |
| Location: | 706786 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g254650 | (1 of 1) K13127 - RING finger protein 113A (RNF113A, CWC24) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTCGCAGCCATCACCACGGCACGCCACACCAGACCTCAACCCCGCCTG |
| Internal bar code: | CGACGCTATTAGAAAGTCTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 758 |
| LEAP-Seq percent confirming: | 9.09091 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACGTGTGCAAGGACTACA |
| Suggested primer 2: | GTTGCAGTCAAGTTGCTGGG |