| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.065853 |
| Chromosome: | chromosome 15 |
| Location: | 719045 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g637350 | TRM3,TMG13 | tRNA (guanosine-2'-O)-methyltransferase; (1 of 2) PTHR12029//PTHR12029:SF11 - RNA METHYLTRANSFERASE // METHYLTRANSFERASE TARBP1-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTAATCATGACGCCGACGCTGCATCCGCACAAGACACACACACACACA |
| Internal bar code: | TAAGGCGTCTTTTTAAAAATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2064 |
| LEAP-Seq percent confirming: | 83.1933 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 119 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTCACACACACACACACAC |
| Suggested primer 2: | GCCCGACCTCAACTAACACA |