Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.065863 |
Chromosome: | chromosome 6 |
Location: | 7063963 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g297650 | UBC36 | (1 of 1) K10582 - ubiquitin-conjugating enzyme E2 Q (UBE2Q); E2 ubiquitin conjugating enzyme | 3'UTR |
Cre06.g297700 | (1 of 1) IPR013026//IPR019734//IPR027417 - Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCTTCATTCCGCAGTGCGTGCCTGCCCAGTTGCGCACGCCAAGCTTG |
Internal bar code: | AGCATTAGACTATATGAGATAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2195 |
LEAP-Seq percent confirming: | 98.5916 |
LEAP-Seq n confirming: | 70 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTTGACAACATGCAGGCG |
Suggested primer 2: | TGGTCGACCTTCACATGTGG |