Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.065871 |
Chromosome: | chromosome 1 |
Location: | 3549860 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g023100 | (1 of 6) IPR001471//IPR016177 - AP2/ERF domain // DNA-binding domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCTTGGTATGGATGACCGGGCGGGCTTGACAGAACCTGACATGCTTC |
Internal bar code: | ATTACAAGGAGCCGCAAAAACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2054 |
LEAP-Seq percent confirming: | 94.1176 |
LEAP-Seq n confirming: | 32 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGCCGTGTTCACAAACAG |
Suggested primer 2: | GCTAACAGCGACGACTACGA |